HomeРазноеPhytolacca acinosa: Лаконос ягодный — Википедия

Phytolacca acinosa: Лаконос ягодный — Википедия

Содержание

Phytolacca acinosa (PHTES)[Overview]| EPPO Global Database

Phytolacca acinosa(PHTES)

Overview

Code created in: 1996-10-28

Basic information

  • EPPO Code: PHTES
  • Preferred name: Phytolacca acinosa
  • Authority: Roxburgh

Notes

Himalayas, Indochina (Myanmar), China, Japan, Korea. Locally introduced in Europe and USA


Other scientific names

Name Authority
Phytolacca esculenta van Houtte

Common names

Name Language
Indian pokeberry
English
Indian pokeweed English
asiatische Kermesbeere German
chinesische Kermesbeere German
eßbare Kermesbeere German
phytolaque d’Orient French
raisin d’Amérique comestible French
cremesina uva turca esculenta Italian
oosterse karmozijnbes Dutch
kermesbär Swedish
yamagobô Japanese
ヤマゴボウ Japanese
лаконос виноградный Russian
лаконос костянковый
Russian
лаконос многоплодниковый Russian
лаконос съедобный Russian
лаконос ягодный Russian
фитолакка костянковая Russian
фитолакка съедобная Russian
Asiatisk kermesbær Danish
kermesbær Norwegian
keermesmarja Finnish
kínai alkörmös Hungarian
shāng liù Chinese
商陆 Chinese
líčidlo jedlé Czech
자리공 Korean
ja ri gong Korean
líčidlovka jedlá Slovak

Лаконос виноградный, или многокостянковый (Phytolacca Acinosa Roxb.

)

Читайте также

Виноградный сок

Виноградный сок Содержит много калия, обычно обогащен витамином С, красный виноградный сок содержит вещество, снижающее риск заболевания сердца. Рекомендуют при нервном истощении и упадке сил. Богатство виноградным сахаром обуславливает антитоксические свойства,

PHYTOLACCA

PHYTOLACCA Сопоставительное сравнениеНЕКОТОРЫЕ СРЕДСТВА ПРИ КРЕСТЦОВО-ПОЯСНИЧНОМ РАДИКУЛИТЕ (ИШИАСЕ)В этой книге разобрано много лекарств, показанных при ишиасе, таких, как ARSENICUM ALBUM, BELLADONNA, BRYONIA, CHAMOMILLA, NUX VOMICA, PHYTOLACCA, PLUMBUM, RHUS TOXICODENDRON, SULPHUR и т. д. Принимая во внимание

ИНДЕЙСКИЙ ПЛЮЩ (PHYTOLACCA.

PHYTOLACCA DECANDRA)

ИНДЕЙСКИЙ ПЛЮЩ (PHYTOLACCA. PHYTOLACCA DECANDRA) Сродственные лекарства. Kali bichromicum, Kali jodatum, Iris, Mercurius jodatus, Jodium, Mezereum, Sanguinaria, Podophyllum, Arsenicum, Silicea, Strychnia, Sulfur; Ipecacuanha.Специфическое действие. На желудок, кишки, кожу и нервную систему; железистый аппарат, особенно на щитовидную и женскую грудную

Phytolacca decandra Индийский плющ

Phytolacca decandra Индийский плющ Фитолакка — бледнолицый, с наклонностью к полноте; занимает промежуточное место между брионией и рус. Для этого типа характерны невралгические боли, боли во всех мышцах, усиливающиеся при движении. Боли фитолакки сравнивают с прохождением

Phytolacca

Phytolacca Phytolacca/Фитолякка — лаконос Основные лекарственные формы. Гомеопатические гранулы D3, C3, C6 и выше. Капли D2, D3, C3, C6 и выше. Настойка Фитолякки для наружного применения. Показания к применению. Назначение препарата оправдано при последующем лечении отягощённости

Phytolacca

Phytolacca Лаконос американскийБоли, болезненность; беспокойство, прострация — вот общие симптомы Phytolacca. В первую очередь это средство показано при заболеваниях желез: опухание желез с жаром и воспалением. Эффективно действует на фиброзную и костные ткани; на фасции и

Виноградный сок

Виноградный сок Является хорошей профилактикой простатита. Ежедневно нужно выпивать по 300—400 мл сока, разбив их на небольшие

Phytolacca и Mercurius

Phytolacca и Mercurius Необходимо запомнить, что эти два лекарства несовместимы, т.  к. легко можно назначить их вместе больному застарелым сифилисом или врожденным сифилисом: оба эти лекарства действуют на железы, слизистые оболочки и кости, с ухудшением во влажную погоду, но при

Виноградный сок

Виноградный сок Содержит много калия, обычно обогащен витамином С; красный виноградный сок содержит вещество, снижающее риск заболевания сердца. Рекомендуют при нервном истощении и упадке сил. Богатство виноградным сахаром обуславливает антитоксические свойства,

Виноградный сок

Виноградный сок Виноград – 2 кгСода питьевая – 1 чайная ложкаВиноград вымыть холодной водой, подсушить и осторожно размять ягоды, чтобы не раздавить косточки. Полученную массу протереть через сито и довести до кипения на медленном огне при постоянном помешивании. В

Виноградный сок

Виноградный сок Виноградный сок применяют, прежде всего, как источник витаминов и минеральных веществ. В винограде содержится большое количество легкорастворимых сахаров, в частности глюкозы.Виноградный сок оказывает тонизирующее, бактерицидное, мочегонное,

Виноградный сок

Виноградный сок Виноградный сок с древних времен известен людям своими целебными свойствами. Лечение виноградом для красоты, силы и здоровья применялось еще в Древней Греции и Древнем Риме. Тогда медики назначали виноград и сок из винограда для улучшения обмена веществ,

Виноградный сок

Виноградный сок Виноградный сок с древних времен известен людям своими целебными свойствами. Лечение виноградом для красоты, силы и здоровья применялось еще в Древней Греции и Древнем Риме. Тогда медики назначали виноград и сок из винограда для улучшения обмена веществ,

Виноградный сок

Виноградный сок ? способ приготовленияВиноград хорошо промыть, обсушить. Переложить в соковыжималку и отжать

Лаконос, или Фитолакка (Phytolacca)

Лаконос, или Фитолакка (Phytolacca) Семейство лаконосные.Сок плодов окрашен в темно-красный цвет – отсюда и название растения: в переводе с латинского «лака» означает «красный сок». В винодельческих районах Южной Европы этот сок используют для окрашивания светлых вин.

Лаконос американский, или десятитычинковый (Phytolacca Americana L.

= Ph. Decandra L.)

Лаконос американский, или десятитычинковый (Phytolacca Americana L.= Ph. Decandra L.) Распространение и места обитанияРодом из восточных районов США и Бермудских островов. На Кавказе его можно встретить как заносное, сорное растение у дорог и жилищ.Ботаническое описаниеМноголетнее

  • 1 лаконос

    Русско-английский технический словарь > лаконос

  • 2 фитолакка

    Русско-английский технический словарь > фитолакка

  • 3

    кермес

    Универсальный русско-английский словарь > кермес

  • 4 лаконос

    2) Botanical term: pokeberry , pokeweed , phytolacca americana, phytolacca decandra, pocan bush, poke (phytolacca decandra)

    Универсальный русско-английский словарь > лаконос

  • 5 лаконос американский

    Универсальный русско-английский словарь > лаконос американский

  • 6 лаконос десятитычинковый

    Универсальный русско-английский словарь > лаконос десятитычинковый

  • 7 лаконоска

    Универсальный русско-английский словарь > лаконоска

  • 8 митоген

    Универсальный русско-английский словарь > митоген

  • 9 фитолакка

    Универсальный русско-английский словарь > фитолакка

  • 10 фитолакка американская

    3) Botanical term: American pokeweed , coakum , poke , pokeroot , pokeweed , redweed , scoke

    Универсальный русско-английский словарь > фитолакка американская

  • 11 фитолакка декандра

    Универсальный русско-английский словарь > фитолакка декандра

  • 12 фитолакка съедобная

    Универсальный русско-английский словарь > фитолакка съедобная

  • 13 экстракт лаконоса

    Универсальный русско-английский словарь > экстракт лаконоса

  • 14 лаконос

    Универсальный русско-немецкий словарь > лаконос

  • 15 лаконос американский

    Русско-английский биологический словарь > лаконос американский

  • 16 фитолакка американская

    3) бот. inkberry

    7) бот. pokeweed

    9) бот. scoke

    Русско-английский биологический словарь > фитолакка американская

  • 17 фитолакка съедобная

    Русско-английский биологический словарь > фитолакка съедобная

  • 18 лаконос

    Новый русско-английский словарь > лаконос

  • 19 фитолакка

    Новый русско-английский словарь > фитолакка

  • 20 лаконос американский

    м

    Wein-Kermesbeere (f), amerikanische Phytolacca (f)

    Русско-немецкий словарь лекарственных растений > лаконос американский

  • Фитолакка ягодная.

    Посадка, размножение, уход, сорта, фото на Supersadovnik.ru

    Экзотический облик и не менее экзотическое название… Сразу ожидаешь, что речь пойдет об изнеженной тропической красавице. Но фитолакка обходится без оранжерей – запросто растет в российском климате под открытым небом.

    Мы привыкли считать, что травянистые растения в общем-то скромники: рост у них – вполовину человеческого, листья – не больше ладони. И когда видим травы богатырского сложения – к примеру, сахалинскую гречиху или борщевик Сосновского, – то невольно задерживаем на них взгляд.

    Фитолакка – из этой же компании. Высокий рост, мощный стебель, крупные листья на прочных черешках, броские соцветия, яркая сочная окраска, уверенный и горделивый вид… Декоративная культура в полном смысле этого слова. Строго говоря, фитолакка – не такая уж редкость в земной флоре, и ареал ее достаточно широк. Разные виды обитают в тропических и субтропических районах Северной и Южной Америки, в Африке и Юго-Восточной Азии. Один из видов фитолакки натурализовался на Кавказе и встречается там среди рудеральной флоры. (Рудеральные растения – растения, встречающиеся около жилья, по обочинам дорог, у заборов, по пустырям, то есть на почвах необрабатываемых, но подвергающихся воздействию человека.)

    Она возглавляет семейство фитолакковых (Phytolaccaceae), включающее 17 родов. Род собственно фитолакки насчитывает около 35 видов. Свое название он получил от греческого слова phyton («растение») и латинского lacca («сок», «лак»).

    Название дано «по естеству» – в плодах многих видов фитолакки содержится бордово-красный лакоподобный сок. Отсюда и русское название растения – лаконос.

    Фитолакка – очень ценный неприхотливый декоративный многолетник с броской наружностью. Она прекрасно справляется с ролью фокусного растения, притягивающего взгляд. Вокруг нее живописной группой можно размещать травянистые и древесные культуры. Во второй половине лета и осенью ни одно из растений этой группы не сможет конкурировать с фитолаккой, потому что сезонный акцент декоративности у большинства из них приходится на весну и первую половину лета.

    Фитолакку можно применять для декорирования стен, заборов, задней части цветников с фронтальной экспозицией. Вместе с кустарниками и высокими травянистыми многолетниками – волжанкой, дельфиниумом, кардиокринумом, наперстянкой, эремурусом – фитолакка составит эффектный миксбордер, особенно если расположить ее на заднем плане.

    Фитолакка – растение не только декоративное, но и лекарственное. Она включена в государственные фармакопеи США и Японии. В медицинских целях используют корневища, листья и плоды. Ее лечебные свойства обусловлены высоким содержанием разнообразных биологически активных и экстрактивных веществ, благодаря которым фитолакку можно назвать «лабораторией на корню». Лечебные препараты из нее обладают общеукрепляющим, тонизирующим, противовоспалительным, антиревматическим и слабительным действием.

    Однако самолечение фитолаккой и препаратами из нее недопустимо. Дело в том, что все части растения, кроме зрелых плодов, сильно ядовиты. Только зрелые плоды считаются условно съедобными, по вкусу напоминают плоды черной бузины, но в больших количествах поедать их не рекомендуется. Особо любопытным взрослым можно съесть несколько спелых ягод, однако семена лучше не проглатывать. Ни в коем случае не подпускайте к фитолакке детей – ее плоды слишком соблазнительны. От использования ягод в домашней кулинарии тоже лучше воздержаться.

    РЕКОМЕНДАЦИИ ПО УХОДУ

    Плохо растет при сильном затенении.

    Необходима легкая, слабокислая, хорошо гумусированная почва.

    Полив — только в сильную жару и засуху. Зимостойкая.

    Практически не поражается болезнями и вредителями.

    Phytolacca acinosa | Руководство по чужеродным растениям Бельгии

    Phytolacca acinosa Roxb. (вкл .: P. esculenta Van Houtte) (E-As.) — Растущий, натурализованный в местном масштабе садовый побег. Впервые отмечен в 1960 г. на осыпи склона Альбертканала в Канне. С 1990 года он рассматривается как городской сорняк во многих городах: Антверпене, Брюгге, Брюсселе, Генте, Изегеме, Кортрейке, Лёвене, Льеже, Менене, Тилте, Тонгерене и, несомненно, в других местах. Phytolacca acinosa чаще всего встречается в садах или парках (под деревьями или кустами, у подножия стен и т. Д.), На кладбищах или в городских пустырях.Он дает ягодоподобные плоды, которые часто едят птицы, и большинство популяций, очевидно, принадлежат птицам. Phytolacca acinosa часто встречается у единичных экземпляров, но все чаще регистрируются более или менее пышные популяции. К настоящему времени это можно считать полностью натурализованным, и нельзя исключать инвазивное поведение в будущем.

    Образец гербария


    Phytolacca acinosa рассматривается здесь в широком смысле, включая все родственные восточноазиатские таксоны, культивируемые для украшения ( P. esculenta и P. latbenia (Buch.-Ham.) H. Walter). Различие этих таксонов имеет решающее значение, и диагностические признаки часто совпадают. Клемент (1982, 1998) предоставляет идентификационный ключ, который включает все второстепенные таксоны Phytolacca , культивируемые (и как ускользнувшие) на Британских островах. Бельгийские коллекции группы Phytolacca acinosa обычно более или менее промежуточны между P. acinosa и P. esculenta : оси соцветий часто чешуйчато-железистые (как у P.acinosa ), но цветочные признаки больше напоминают P. esculenta . Phytolacca latbenia (с 10–16 тычинками вместо 7–9), возможно, более отчетлив, и также был заявлен как побег в Бельгии. Последние систематики склонны включать эти второстепенные таксоны в широко ограниченную группу Phytolacca acinosa (см., Например, Ghosh & Sikdar 1983, Dequan & Larsen 2003).

    Другой азиатский вид, Phytolacca polyandra Batalin (син . : P.clavigera W.W. Смит), натурализован на Британских островах (Clement & Foster, 1994). Вероятно, он более тесно связан с Phytolacca americana (оба имеют общие сросшиеся в основании плодолистики), но в остальном очень похож по внешнему виду на P. acinosa . Это могло быть упущено или, возможно, также должно быть включено в синоним Phytolacca acinosa (см., Например, van der Meijden 2005).

    Phytolacca acinosa часто путают с P.americana в Бельгии. Фактически, многие записи последнего, несомненно, принадлежат Phytolacca acinosa , безусловно, самому распространенному представителю этого рода в Бельгии. Phytolacca acinosa всегда представляет собой растение гораздо меньшего размера (редко превышающее 100 см) с прямостоячим соцветием и более широкими листьями. Более того, по крайней мере в Бельгии, он начинает цвести намного раньше: Phytolacca acinosa начинает цвести с мая, тогда как Phytolacca americana не зацветает раньше июля.


    Избранная литература

    Адольфи К. (1995) Neophytische Kultur- und Anbaupflanzen als Kulturflüchtlinge des Rheinlandes. Нардус 2 : 272 с.

    Балог Л. (2005) Phytolacca esculenta Van Houtte Magyarországon. Флора Панноника 3 : 135-161.

    Клемент Э.Дж. (1982) Pokeweeds (Phytolacca ssp.) В Великобритании. Новости BSBI 32 : 22-23.

    Клемент Э.Дж. (1998) Phytolacca. В: Rich T.C.G. И Джерми А.С. (ред.), Plant crib: 79. BSBI, London.

    Клемент Э.Дж. И Фостер М. (1994) Чужеродные растения Британских островов. BSBI, Лондон: XVIII + 590 с.

    Декван Л. и Ларсен К. (2003) Phytolaccaceae. В: Wu Z.Y. и др. (ред.), Флора Китая, т. 5. Science Press, Beijing & Missouri Botanical Garden Press, Сент-Луис: 435-436.

    Dieu J. -M., Lambinon J. & Rousselle J. (1997) Quatre adventices sur les trottoirs de la ville de Liège: Catapodium marinum, Diplotaxis muralis, Elsholtzia ciliata et Phytolacca esculenta. Нац. Мосана 50 (1) : 17-18.

    Гош Р. Б. и Сикдар Дж. К. (1983) Пересмотр индийских Phytolaccaceae (sensu lato). J. Econ. Таксон. Бот. 4 (1) : 153-163.

    Skalický V. (1972) Lícidlo jedlé (Phytolacca esculenta van Houtte), nový zplanĕlý druh kvĕteny ČSSR a NDR и rozšíření druhů Phytolacca esculenta van Houtte a P.americana L. в ЧССР. Preslia 44 (4) : 364-369.

    Терпо А. и Балинт К.Э. (1985) A `karmazsinbogyo ‘(Phytolacca) fajok kiwadulasa es a Ph. Americana meghonosodasa Magyarorszagon. Бот. Közlem. 72 (1-2) : 127-139.

    Ван дер Мейден Р. (2005) Флора ван Недерланд Хойкельса (23 дня). Вольтерс-Нордхофф, Гронинген: 685 стр.

    Verloove F. (2002) Ingeburgerde plantensoorten во Фландерене.Mededeling van het Instituut voor Natuurbehoud n ° 20: 227 p.

    Verloove F. (2006) Phytolacca esculenta. В: Van Landuyt W., Hoste I., Vanhecke L., Van den Bremt P., Vercruysse W. & De Beer D., Atlas van de Flora van Vlaanderen en het Brussels gewest. Instituut voor Natuur- en Bosonderzoek, Nationale Plantentuin van België en Flo.Wer: 666.

    Wyrzykiewicz-Raszewska M. (2009) Phytolacca acinosa Roxb. — новый антропофит во флоре Польши. Стециана 13 : 3-7. [доступно на сайте: http://merlin.up.poznan.pl/steciana/wp-content/uploads/2014/03/13_Stec_1_Wyrz.pdf]

    Зелиньски Ю., Петрова А., Начева Р. (2012) Новые виды для болгарской флоры. Phytol. Балканика 18 (2) : 197-204. [доступно на сайте: http://www.bio.bas.bg/~phytolbalcan/PDF/18_2/18_2_13_Zielinski_&_al. pdf]

    микросателлитов для Phytolacca acinosa (Phytolaccaceae), традиционной лекарственной травы

    Appl Plant Sci.2017 Октябрь; 5 (10): apps.1700028.

    Yueqin Cheng

    2 Колледж защиты растений, Хэнаньский сельскохозяйственный университет, Чжэнчжоу 450002, Китайская Народная Республика

    Pingping Li

    2 Колледж защиты растений, Хэнаньский сельскохозяйственный университет, Чжэнчжоу 450002, Китайская Народная Республика

    Yi Yang

    2 Колледж защиты растений, Хэнаньский сельскохозяйственный университет, Чжэнчжоу 450002, Китайская Народная Республика

    Jianhang Zhang

    2 Колледж защиты растений, Хэнаньский сельскохозяйственный университет, Чжэнчжоу 450002, Китайская Народная Республика

    Fengming Yan

    2 Колледж защиты растений, Хэнаньский сельскохозяйственный университет, Чжэнчжоу 450002, Китайская Народная Республика

    Hongwei Wang

    2 Колледж защиты растений, Хэнаньский сельскохозяйственный университет, Чжэнчжоу 450002, Китайская Народная Республика

    2 Колледж защиты растений ction, Хэнаньский сельскохозяйственный университет, Чжэнчжоу 450002, Китайская Народная Республика

    1 Эта работа была поддержана Национальным фондом естественных наук Китая (31670389).

    Поступило 27.05.2017; Принято 16 августа 2017 г.

    Copyright © 2017 Cheng et al. Опубликовано Ботаническим обществом Америки Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC-BY-NC-SA 4.0), которая разрешает неограниченное некоммерческое использование и распространение при условии указания автора и источника новая работа распространяется под той же лицензией, что и оригинал.

    Abstract

    Предпосылка исследования:

    Phytolacca acinosa (Phytolaccaceae) — это традиционное китайское растение с множеством медицинских применений и важный источник пигментов.Из-за чрезмерного промысла людьми численность и размеры популяции резко сократились.

    Методы и результаты:

    Используя расширенную геномную библиотеку, мы разработали и охарактеризовали 15 микросателлитных праймеров для P. acinosa , 13 из которых были полиморфными. Количество аллелей варьировало от двух до семи. Наблюдаемая гетерозиготность и ожидаемая гетерозиготность на локус варьировались от 0,267 до 1000 и от 0,331 до 0,743 соответственно. Все разработанные праймеры также были успешно применены к P.американа .

    Выводы:

    Эти маркеры должны быть полезны при исследовании генетического разнообразия, генетической структуры и систем спаривания P. acinosa , которые могут предоставить информацию о защите и устойчивом промысле этого вида.

    Ключевые слова: генетическая консервация, микросателлит, Phytolacca acinosa , Phytolacca americana , Phytolaccaceae

    Phytolacca acinosa Roxb., Принадлежит к семейству Phytolacca acinosa Roxb., Принадлежит к семейству Phytolaccrenacenaceae, родом из Восточной Азии, родом из горных растений Восточной Азии, родом из восточноазиатских травянистых растений., 2002). Его большие мясистые корни содержат полисахариды, белки и тритерпеноидный сапонин и служат традиционной китайской травой с множеством медицинских применений, включая антибактериальные, противовоспалительные, противовирусные, противораковые и средства повышения иммунитета (Zhang et al. , 1990; Gao и др., 2009). Среди них выделяются противовоспалительные и повышающие иммунитет свойства, что позволяет предположить, что это растение потенциально может быть использовано для разработки лекарства для борьбы с аутоиммунными заболеваниями в будущем (Li and Yao, 2011).Кроме того, некоторые предыдущие результаты показали, что его можно использовать в качестве источника красного цвета при окрашивании шерстяной ткани или в качестве пищевой добавки (Zhao et al., 2014; Wu et al., 2016). По этим причинам в последние годы в Китае был произведен чрезмерный вылов P. acinosa , что привело к резкому сокращению численности и размеров популяции. Для защиты и устойчивого сбора этого ценного растительного ресурса нам нужна информация о генетическом разнообразии, генетической структуре и системах спаривания видов на основе молекулярных маркеров.В предыдущем исследовании микросателлитные маркеры были разработаны для конгенера P. americana L .; однако эти праймеры имели очень ограниченное применение в P. acinosa (Bentley et al., 2015). В этом исследовании мы разработали набор микросателлитных локусов (простой повтор последовательности [SSR]) для P. acinosa , которые можно использовать для описания паттернов его генетического разнообразия. Межвидовая амплификация была также протестирована на одной популяции P. americana .

    МЕТОДЫ И РЕЗУЛЬТАТЫ

    Образцы листьев P.acinosa были собраны в Чжумадянь (ZMD), Синми (XM) и Пекине (BJ), Китай (Приложение 1). Геномную ДНК экстрагировали из высушенных силикагелем листьев с использованием модифицированного метода бромида цетилтриметиламмония (CTAB) (Fang et al., 2009). Один из образцов геномной ДНК был выбран для создания библиотеки, богатой микросателлитами, с использованием следующего метода: геномная ДНК была дважды расщеплена смесью ферментов Rsa I и XMn I. Затем два адаптера были лигированы к расщепленной ДНК (прямой: 5′-GTTTAAGGCCTAGCTAGCAGAATC-3 ‘; обратный: 5′-GATTCTGCTAGCTAGGCCTTAAACAAAA-3’). Фрагменты с адаптерами на обоих концах разделяли с помощью электрофореза в 1,5% агарозном геле, и фрагменты ДНК длиной от 400 до 1200 п.н. выделяли с помощью набора для экстракции геля QIAquick (QIAGEN, Шанхай, Китай). Собранные фрагменты гибридизовали с тремя различными меченными биотином зондами (New England Biolabs, Пекин, Китай): (AG) 8 , (AC) 8 и (ATG) 12 . Затем продукты гибридизации улавливали с помощью магнитных шариков, покрытых стрептавидином.Наконец, полученные фрагменты вставляли в простой вектор pMD18-T (TaKaRa Biotechnology Co., Далянь, Китай), а затем трансформировали и клонировали в клетки DH5α (TaKaRa Biotechnology Co.). Положительные клоны тестировали с помощью ПЦР-амплификации с использованием праймеров M13F (5′-TGTAAAACGACGGCCAGT-3 ‘) и M13R (5′-CAGGAAACAGCTATGACC-3’).

    Всего было отобрано 110 положительных клонов и секвенировано с использованием анализатора ДНК ABI 3730 (Applied Biosystems, Фостер-Сити, Калифорния, США), 46 из которых содержали SSR.Двадцать три пары микросателлитных праймеров были сконструированы с использованием Primer Premier 5.0 (PREMIER Biosoft International, Пало-Альто, Калифорния, США) и протестированы на шести случайно выбранных особях из P. acinosa из разных популяций. ПЦР проводили в общем объеме 10 мкл, содержащем приблизительно 5–20 нг ДНК-матрицы, 0,25 мкМ прямые праймеры, 0,25 мкМ обратные праймеры и 1 × смесь для ПЦР (Tiangen Biotech, Пекин, Китай). Микросателлитные локусы тестировали на амплификацию в следующих условиях: 94 ° C в течение 5 мин; 35 циклов 94 ° C в течение 35 с, температура отжига оптимизирована для каждого праймера в течение 30 с () и 72 ° C в течение 1 мин; и окончательное удлинение при 72 ° C в течение 10 мин.Амплифицированные продукты разделяли на 6% полиакриламидном геле и визуализировали с помощью окрашивания серебром. В общей сложности 15 пар праймеров были успешно амплифицированы, давая разборчивые продукты ожидаемого размера фрагментов. Среди них было отобрано 13 пар праймеров, каждая из которых способна амплифицировать два или более аллелей, для определения генотипов всех образцов из трех популяций P. acinosa из Чжумадянь (ZMD), Xinmi (XM) и Пекина (BJ). (). Реакции генотипирования проводили с использованием трех праймеров: прямого SSR-специфического праймера с хвостом M13 на 5′-конце, обратного SSR-специфичного праймера и меченного флуоресцентным красителем (FAM или HEX) универсального праймера M13 по методу Шуэльке (2000).Аллели анализировали с помощью GeneMapper версии 4.0 (Applied Biosystems). Количество аллелей на локус ( A ), наблюдаемая гетерозиготность ( H o ), ожидаемая гетерозиготность ( H e ) и равновесие Харди – Вайнберга (HWE) были рассчитаны с использованием Arlequin Suite версии 3.5 ( Excoffier и Lischer, 2010). Кроме того, перекрестная амплификация была проведена в одной популяции ( N = 33) из P. americana ().

    Таблица 1.

    Характеристика 15 микросателлитных локусов из Phytolacca acinosa .

    F: CTCCTGAATCTGATGGTGAA 903 903 17 903–19 Ent6 нуклеотид «,» attrs «: {» текст «:» KP133131 «,» term_id «:» 758424992 «,» term_text «:» KP133131 «}} KP133131 903 , «attrs»: {«text»: «KY810487», «term_id»: «1189933094», «term_text»: «KY810487»}} KY810487 903
    Локус Последовательности праймеров (5’– 3 ‘) Повторяющийся мотив Диапазон размеров аллелей (п.о.) T a (° C) Номер доступа GenBank.
    SL-34 F: TGTCCACCATAAAACACTT (ATC) 3 165–182 49,1 {«type»: «entrez-nucleotide», «text attrs»: {» «:» KP133119 «,» term_id «:» 758424833 «,» term_text «:» KP133119 «}} KP133119
    R: CCTCTTTCGCTACTTGC (ATC) 6 162–167 51.1 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP133120», «term_id»: «758424849», «term_text»: «KP133120»}} KP133120
    R: AGTTGTGCGTGTTGAAGAAG
    SL-116 F: AGCCCCATACTCTACATC (ATC) 5 305–19 «Ent. нуклеотид «,» attrs «: {» текст «:» KP133121 «,» term_id «:» 758424866 «,» term_text «:» KP133121 «}} KP133121
    R: CTCTTCTTTCTTTCTGTG18
    SL-160 F: CATAACCAAGGAGGCAGA (ATC) 6 376–419 53.7 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP133122», «term_id»: «758424882», «term_text»: «KP133122»}} KP133122
    R: ACAAGAAGAAAGAGGGTGAC
    SL-164 F: AGTTCACACACAAAGGG (AC) 9 234–24 Ent4 нуклеотид «,» attrs «: {» текст «:» KP133123 «,» term_id «:» 758424898 «,» term_text «:» KP133123 «}} KP133123
    R: AGGCTAATACCACGGATA
    SL-200 F: TCCAACCCCCATCTCAAG (GAT) 5 157–166 55.9 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP133124», «term_id»: «758424915», «term_text»: «KP133124»}} KP133124
    R: CAAGATGCCCACCAATGA
    SL-287 F: CAAGGAAGAACAAGG (CAT) 7 130–135 Ent нуклеотид «,» attrs «: {» text «:» KP133125 «,» term_id «:» 758424931 «,» term_text «:» KP133125 «}} KP133125
    R: TAGGTGAGAGAAGGAGT
    SL-307 F: GCCCCATTTCTTTTATTC (TCA) 4 229–235 49.6 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP133126», «term_id»: «758424946», «term_text»: «KP133126»}} KP133126
    R: AAGGGTCTTGGTGTT GAT
    SL-324 F: TGGAAAGGTCGCTAATAC (TCA) 4 900.2 125–13 «тип 4 125–13″ {тип -nucleotide «,» attrs «: {» text «:» KP133127 «,» term_id «:» 758424955 «,» term_text «:» KP133127 «}} KP133127
    R: AAACACAAGGCTTCTGAG18
    SL-377 Ф: TGGACCCCTCTGCTACT (TGA) 8 253–307 53.2 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP133128», «term_id»: «758424964», «term_text»: «KP133128»}} KP133128
    R: GGACACCTCATCAGTAAA
    SL-379 F: ATTTGGGTACTTGGGGAC (GTT) 4 443–44 « 4 443–44″ 4 443–44 » нуклеотид «,» attrs «: {» текст «:» KP133129 «,» term_id «:» 758424968 «,» term_text «:» KP133129 «}} KP133129
    R: TTTGATTTGGGAGGGACT
    SL-385 F: GAATGATGGGACAAGGA (ATG) 3 383–394 53.3 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KP133130», «term_id»: «758424978», «term_text»: «KP133130»}} KP133130
    R: CAAACGCAAACGCTAGTATA
    SL-546 F: CCATCCATTCATCCTTTG (ATC) 4 293–19 ent6
    R: ATTCACTATTCTTGGCTTC
    SL-269 F: GCCCACTAAGCCCAAACT (AC) 12 251 46.9 {«type»: «entrez-нуклеотид», «attrs»: {«text»: «KY810486», «term_id»: «1189933093», «term_text»: «KY810486»}} KY810486
    R: CTATGGAGGTTGAGGATGGT
    SL-362 F: ATATAGACAGCCTTCCAC (GAT) 3 215 215 215
    R: ATCCATACACACACACAAAT

    Таблица 2.

    Генетическое разнообразие в четырех популяциях Phytolacca на основе 13 разработанных полиморфных микросателлитных маркеров. a

    1 o 563 *
    Локус Phytolacca acinosa Phytolacca americana
    ZMD ( N = 21) B XM ( N ) = 18) ZZ ( N = 33)
    A H o H e b A H e b A H o H e b 8 A 8 H e b
    SL-34 6 0.438 0,470 2 0,267 0,331 3 0,412 0,348 3 0,313 0,280
    SL-58 3 0,813 0,813 0,667 0,497 4 0,824 0,586 3 0,813 0,571
    SL-116 4 0,417 0.525 3 0,667 0,480 3 0,470 0,383 2 0,625 0,444
    SL-160 2 0,625 0,444 0,476 3 0,765 0,508 * 2 0,625 0,444
    SL-164 4 0,867 0,582 4 0.733 0,545 * 2 0,688 0,466 4 0,813 0,760 *
    SL-200 6 0,813 0,669 3 0,991 5 0,941 0,722 * 3 0,938 0,615 *
    SL-287 6 0,733 0,605 * 2 0,667 0.460 2 0,941 0,513 ** 3 0,813 0,534 *
    SL-307 3 0,692 0,495 2 0,5033 0,529 0,415 3 0,500 0,401
    SL-324 6 0,688 0,641 3 0,533 0,497 * 3 0,462 2 0,625 0,444
    SL-377 3 0,727 0,589 * 3 1.000 0,618 * 7 0,7 0,8 * 4 1.000 0,724 *
    SL-379 5 0,667 0,656 3 0,429 0,540 3 0,412 0.426 * 2 0,688 0,466
    SL-385 4 0,750 0,558 2 0,467 0,370 2 0,529 0,401 0,625 0,444
    SL-546 5 0,358 0,429 3 0,400 0,432 3 0,529 0,415 2 0.688 0,466

    Тринадцать праймеров были успешно использованы для амплификации локусов SSR для всех образцов из популяций P. acinosa и P. americana . Для P. acinosa , A варьировала от двух до семи на локус, а H o и H e варьировала от 0,267 до 1.000 и от 0,331 до 0,743 соответственно (). Было обнаружено, что несколько локусов значительно отклоняются от HWE: два в популяции ZMD, четыре в популяции XM и пять в популяции BJ.Для P. americana , A варьировала от двух до четырех, а H e и H o варьировала от 0,280 до 0,760 и от 0,313 до 1000 соответственно ().

    ВЫВОДЫ

    В данной работе мы разработали 13 полиморфных микросателлитных маркеров для P. acinosa , которые также были успешно применены для P. americana . Эти локусы могут быть полезны для исследования генетического разнообразия, генетической структуры и систем спаривания P.acinosa , которые могут предоставить информацию о защите и промысле этого вида.

    Приложение 1.

    Ваучерная информация на видов Phytolacca , использованных в этом исследовании.

    Виды Население N Информация ваучера a Населенный пункт Географические координаты
    Phytolacca acinosa Roxbosa. ZMD 21 ZMD201301 Чжумадянь, Хэнань, Китай 35 ° 18′15 ″ с.ш., 110 ° 46′35 ″ в.д.
    P.acinosa XM 23 XM201303 Xinmi, Хэнань, Китай 35 ° 18′15 ″ с.ш., 110 ° 46′35 ″ E
    P. acinosa BJ {«type»: «entrez-нуклеотид», «attrs»: {«text»: «BJ201301», «term_id»: «18369216», «term_text»: «BJ201301»}} BJ201301 Пекин, Китай 41 ° 01’47 ″ с.ш., 115 ° 15’00 ″ в.д.
    P. americana L. ZZ 33 ZZ201401 Чжэнчжоу, Хэнань, Китай 34 ° 26’24 ″ С.ш., 113 ° 25′12 ″ в.д.

    ЦИТИРОВАННАЯ ЛИТЕРАТУРА

    • Bentley K.E., Берриман К. Р., Хоппер М., Хоффберг С. Л., Майхре К. Э., Ивао К., Ли Дж. Б. и др. 2015 г. Одиннадцать микросателлитов в появляющемся захватчике, Phytolacca americana (Phytolaccaceae), из его естественных и интродуцированных ареалов. Приложения в науках о растениях 3: 1500002. [Бесплатная статья PMC] [PubMed] [Google Scholar]
    • Excoffier L., Lischer H. E. L. 2010 г. Arlequin Suite версии 3.5: новая серия программ для выполнения популяционного генетического анализа под Linux и Windows. Ресурсы по молекулярной экологии 10: 564–567.[PubMed] [Google Scholar]
    • Fang X. M., Wang H. W., Cheng Y. Q., Ye Y. Z., Yang C. 2009 г. Оптимизация экстракции тотальной ДНК и тестирование подходящих молекулярных маркеров в Taihangia rupestris . Чжунго Нунсюэ Тунбао 25: 57–60. [Google Scholar]
    • Гао Х. М., Лю Дж. Х., Ван З. М., Ван В. Х. 2009 г. Фитолакацинозид А, новый тритерпеноидный сапонин из Phytolacca acinosa Roxb. Журнал азиатских исследований натуральных продуктов 11: 433–438. [PubMed] [Google Scholar]
    • Li Y.Ф., Яо Г. Т. 2011 г. Обзор фармакологических эффектов и токсичности фитолак. Китайский журнал экспериментальных традиционных медицинских формул 17: 248–251. [Google Scholar]
    • Шуэльке М. 2000 г. Экономичный метод флуоресцентной маркировки фрагментов ПЦР. Природа Биотехнологии 18: 233–234. [PubMed] [Google Scholar]
    • Wu M., Zhao Z. L., Zhan K. H., Chang X. L. 2016 г. Исследование абсорбции и десорбции Phytolacca acinosa . Китайские пищевые добавки 6: 102–107.[Google Scholar]
    • Чжан Дж., Цянь Д., Чжэн К. 1990 г. Влияние полисахаридов I Phytolacca acinosa на цитотоксичность макрофагов и выработку им фактора некроза опухоли и интерлейкина 1. Китайский журнал исследований рака 2: 13–16. [PubMed] [Google Scholar]
    • Zhao C. J., Liu J., Zhu P., Sui S. Y., Dong C. H., Zhang L. 2014 г. Исследование свойств шерсти при окрашивании натуральными ягодными красителями Phytolacca . Журнал по шерстяному текстилю 42: 12–16.[Google Scholar]
    • Чжэн Х. К., Чжао М. С., Ху З. Х. 2002 г. Состояние исследований по распространению и классификации Phytolacca . Журнал Университета Яньань 21: 61–63. [Google Scholar]

    лекарственных трав: INDIAN POKE — Phytolacca acinosa

    Трава: Indian Poke

    Латинское название: Phytolacca acinosa


    Семейство: Phytolaccaceae (семейство Pokeweed)

    Лекарственное использование Indian Poke:

    Корень является противоастматическим, антибактериальным, противоядным, противогрибковым, отхаркивающим средством , слабительное и глистогонное.У растения интересный химический состав, и в настоящее время (1995 г.) оно исследуется как потенциальное лекарство от СПИДа. Он содержит сильнодействующие противовоспалительные средства, противовирусные белки и вещества, влияющие на деление клеток. Эти соединения токсичны для многих болезнетворных организмов, включая водяных улиток, вызывающих шистосомоз. Корень применяют внутрь при лечении заболеваний мочеиспускания, нефрита, отеков и вздутия живота. Наружно его применяют для лечения фурункулов, карбункулов и язв.Корни собирают осенью и сушат для дальнейшего использования. Все части растения токсичны, это средство следует применять с осторожностью и желательно под наблюдением квалифицированного практикующего врача.

    Описание растения:



    Растение:
    Многолетнее
    Высота:
    150 см
    (5 футов)
    Цветение: с
    июля по
    августа
    г.

    Среда обитания травы:

    Долины, склоны холмов, лесные подлески, опушки леса и обочины дорог на высотах 500 — 3400 метров.Он также встречается в возделываемых земельных домах, на влажных плодородных землях и как сорняк.

    Съедобные части индийского поке:

    Листья — их нужно приготовить, а затем использовать как шпинат. Следует использовать только молодые листья, поскольку с возрастом они становятся токсичными. Молодые побеги используются как заменитель спаржи. У них отличный аромат. Корень — приготовленный. Сначала нужно пиявить. В пищу следует употреблять только белый корень белоцветковой формы (если он существует!). См. Примечания выше.

    Другие виды использования травы:

    Из плода получают красные чернила.

    Размножение индийского Poke:

    Семена — сеять осенью или весной в холодных условиях. Когда они станут достаточно большими, чтобы их можно было обрабатывать, наколите саженцы в отдельные горшки и вырастите их в теплице на первую зиму. Высаживайте их на постоянное место в конце весны или в начале лета, после последних ожидаемых заморозков. Если у вас достаточно семян, возможно, стоит попробовать посев на открытом воздухе в грядку ранней весной. Выращивайте растения на семенном ложе в течение их первого года и высаживайте их следующей весной.Деление в марте или октябре. Используйте острую лопату или нож, чтобы разделить подвой, убедившись, что на каждой секции есть хотя бы одна ростковая почка. Очень просто, большие подразделения могут быть размещены прямо на их постоянных позициях. Мы обнаружили, что перед посадкой в ​​конце весны или в начале лета лучше высаживать более мелкие ветви и выращивать их в светлой тени в холодном помещении до тех пор, пока они не станут хорошо укоренившимися.

    Выращивание травы:

    Долины, склоны холмов, лесные подлески, опушки леса и обочины дорог на высоте 500 — 3400 метров.Он также встречается в возделываемых земельных домах, на влажных плодородных землях и как сорняк.

    Известные опасности Phytolacca acinosa:

    Листья ядовиты. Говорят, что их можно безопасно есть в молодом возрасте, а токсины вырабатываются по мере взросления. Согласно другому сообщению, ядовита только форма с красновато-пурпурными цветками и пурпурным корнем.

    Информация о растениях взята из книги «Растения будущего».

    Phytolacca. Тыкать рут. Phytolacca decandra. Phytolacca acinosa.

    Phytolacca . N. F. IV (США, П. VIII). Тыкать рут. Phytolaccae Radix. Корень фитолакки. Расин де Фитолак, Fr. Kermesbeerenwurzel , G .— «Высушенный корень Phytolacca decandra Linné (сем. Phytolaccaceae ), собранный осенью». N. F.

    В прошлом США распознали как корень, так и ягоды растения Phytolacca decandra L. Это местное растение с большим разветвленным многолетним корнем, часто от 20 до 25 см. в диаметре, мясистая, волокнистая, внутри беловатая, покрытая тонкой коричневатой пробкой.Стебли однолетние, часто вырастают до высоты 6-15 дм и делятся на многочисленные раскидистые ветви, которые в молодости зеленые, но становятся пурпурными, особенно в верхних частях после созревания ягод. Листья очередные, яйцевидно-продолговатые, цельные, заостренные, снизу гладко-ребристые, на коротких ножках. Цветки мелкие, в длинных кистях. Кисть цветов становится гроздью темно-пурпурных, почти черных, блестящих ягод, сплющенных сверху и снизу и разделенных на десять локусов, каждая из которых содержит одно семя.

    Poke изобилует во всех частях Соединенных Штатов, процветает вдоль заборов, у границ леса, на недавно вырубленных полях и особенно в навозе, выброшенном из канав или болот. Он также спонтанно растет в Северной Африке и Южной Европе, куда, однако, предположительно был завезен из Америки. Его цветки начинают появляться в июле, а плоды созревают осенью. Размер травки, ее большие густые листья и красивые грозди пурпурных ягод, часто смешанные на одной ветке с зелеными незрелыми плодами и еще цветущими цветами, делают его одним из самых ярких местных растений. .Молодые побеги часто используются в пищу ранней весной, их варят, как спаржу. Пепел от стеблей и листьев, по данным Браконно, составляет не менее 4,2%. гидроксида калия. В растении калий сочетается с кислотой, напоминающей яблочную кислоту. Листья, ягоды и корень используются в медицине, но последний наиболее активен. Его нужно выкопать в конце ноября, нарезать тонкими поперечными дольками и высушить на умеренном огне. Поскольку его достоинства уменьшаются при хранении, каждый год следует закупать новый запас.Ягоды следует собирать, когда они полностью созрели, а листья примерно посередине обломка, когда стебли на ножках начнут краснеть.

    Ягоды ( Phytolaccae Fructus , U. S., 1890, Phytolacca e Baccae , U. S., 1880, Poke Berry ) содержат суккулентную мякоть и дают под давлением большое количество прекрасного пурпурного красного сока. У них сладкий, тошнотворный, слегка едкий вкус, без запаха.

    Высохший корень «цилиндрический, несколько сужающийся, слабо разветвленный, от 3 до 7 см.по толщине, чаще всего в поперечных или продольных срезах; снаружи желтовато-коричневый, мелко продольно или спирально морщинистый и толсто кольчатый с более светлыми невысокими гребнями; перелом фиброзный, характеризующийся чередованием слоев фиброваскулярной ткани и паренхимы, причем слои последней сильно втянуты. Слабый запах; вкус сладковатый, потом сильно едкий. Фитолакка дает не более 14%. ясеня » N. F.

    Согласно анализу Эдварда Доннелли, корень, помимо различных неорганических веществ, содержит дубильную кислоту, крахмал, камедь, сахар, смолу, жирное масло и лигнин. (AJP , xv, 169.) Claussen ( Pharm ., 1879, стр. 466), полученный из семян Phytolacca decandra , экстракцией спиртом, выпариванием досуха и обработкой хлороформом или эфиром, после промывки остатка петролейным бензином, нейтральный принцип в виде шелковистых блестящих кристаллов, нерастворимых в воде, растворимых в спирте, эфире и хлороформе, который он назвал фитолакцином . A. Tereil ( C. R.A. S ., 91, 856) получали из ягод кислоту ( фитолакциновая кислота ) в виде некристаллизующейся желтовато-коричневой массы клейкой консистенции.Он был растворим в воде и спирте, слабо растворим в эфире, кислой реакции и желатинизировался соляной и серной кислотами. В. Ф. Вагнер ( A. J. P. , 1887, стр. 69) обнаружил танин в ягодах, но не в корне. W. A. ​​Partee ( A. J. P ., 1888, p. 123) провел предварительное исследование тыквенного корня и обнаружил кристаллы, выпавшие из раствора спиртового экстракта в абсолютном спирте; он также обнаружил следы танина, глюкозы и признаки, указывающие на присутствие глюкозидного принципа.Франкфортер и Рамали (A. J. P., 1897, 281) снова тщательно проанализировали корень. Они находят почти 10 процентов. из невосстанавливающего сахара, свободной кислоты, идентифицированной как муравьиная кислота, но нет никаких доказательств наличия алкалоида или глюкозида. Очень горькая смола составляла 1 процент; Фитолакцин , алкалоид, как утверждается, присутствует в незначительных количествах в корне.

    Использует . — Phytolacca является рвотным, слабительным и в некоторой степени наркотическим средством. Как рвотное средство, он действует очень медленно, часто не вызывает рвоту менее чем через один или два часа после приема, а затем продолжает действовать в течение длительного времени как на желудок, так и на кишечник.Считается, что рвота, вызываемая им, не сопровождается сильной болью или спазмом, но некоторые врачи наблюдали наркотические эффекты, такие как сонливость, головокружение и помутнение зрения. При передозировке он вызывает сильную рвоту и очищение, сопровождающееся сильным упадком сил, а иногда и судорогами, и в некоторых случаях оказывается смертельным. По словам Роберта Бартолоу, фитолакка вызывает у низших животных судороги и смерть от паралича дыхания. Он не подходит для использования в качестве рвотного средства, но использовался в качестве альтернативного средства при хроническом ревматизме , гранулярном конъюнктивите и даже при раке .Местно он использовался в форме мази (драхма на унцию) при лечении псоры , tinea capitis , сикоза и favus . Сначала это вызывает чувство жжения и тепла в частях, к которым применяется. Спирт, разбавленный спирт и вода извлекают полезные свойства тыквенного корня. Флюидный экстракт включен в Национальный формуляр.

    Доза, рвотное средство, от десяти до тридцати зерен (0,65-2,0 г), альтернативное, от одного до пяти зерен (0.065-0.32 Гм.).

    Phytolacca Acinosa Roxb. (Fam. Phytolaccaceae .) — Это растение долгое время использовалось в Японии в качестве мочегонного средства и считается очень ядовитым. К. Нагаи выделил из него аморфную смолу , фитолаккотоксин , который, по-видимому, вызывает спазмы и в то же время стимулирует кровообращение, вероятно, через вазомоторные центры. ( Sei-i-kwai. Med. Journ ., Апрель 1891 г.)


    Диспансер Соединенных Штатов Америки, 1918 г., редактировал Джозеф П.Ремингтон, Горацио К. Вуд и другие.

    Индийский Poke — Phytolacca acinosa (Индийский Poke)

    Phytolacca acinosa — многолетнее травянистое растение, вырастающее на толстом, мясистом подвое высотой 50–150 см. Завод обеспечивает едой и лекарствами для местного потребления. Его выращивают из-за съедобных листьев в Индии, а иногда и как декоративное. Говорят, что есть две формы этого растения: одна с красными цветками с ядовитым корнем, а другая с белыми цветками с белым съедобным корнем.Говорят, что эту белую форму из-за съедобного корня выращивают в некоторых частях Китая.

    Известные опасности

    Листья ядовиты. Говорят, что их можно безопасно есть в молодом возрасте, а токсины вырабатываются по мере взросления. Согласно другому сообщению, ядовита только форма с красновато-пурпурными цветками и пурпурным корнем.

    Сведения о выращивании

    Растение от теплого умеренного до тропического, в состоянии покоя оно переносит температуры от -5 до -10 ° C.Молодняк может пострадать от заморозков.
    Легко выращиваемое растение, подходит для большинства почв, но предпочитает плодородную почву, сохраняющую влагу, на открытом солнце или в полутени. Растения можно выращивать на довольно грубой траве, которую осенью можно ежегодно стричь.
    Растение часто самосевает, когда находится в подходящем положении.
    Растения кажутся невосприимчивыми к хищникам кроликов.

    Съедобное использование

    Листья — их нужно приготовить, а затем использовать как шпинат. Следует использовать только молодые листья, поскольку с возрастом они становятся токсичными.Молодые побеги используются как заменитель спаржи. У них отличный аромат.

    Корень — приготовленный. Сначала нужно пиявить. В пищу следует употреблять только белый корень белоцветковой формы (если он существует!).

    Лекарственное

    Корень является противоастматическим, антибактериальным, антидотным, противогрибковым, противокашлевым, мочегонным, отхаркивающим, слабительным и глистогонным средством. Корень применяют внутрь при лечении заболеваний мочеиспускания, нефрита, отеков и вздутия живота.
    Наружно корень используется для лечения фурункулов, карбункулов и язв.
    Корни собирают осенью и сушат для дальнейшего использования.
    Все части растения токсичны, это средство следует использовать с осторожностью и желательно под наблюдением квалифицированного практикующего врача.

    У растения интересный химический состав, и в настоящее время (1995 г.) исследуются как потенциальное лекарство от СПИДа. Он содержит сильнодействующие противовоспалительные средства, противовирусные белки и вещества, влияющие на деление клеток. Эти соединения токсичны для многих болезнетворных организмов, включая водяных улиток, вызывающих шистосомоз.

    Другое применение

    Из плода получают красные чернила.

    Распространение

    Семена — сеять осенью или весной в холодном помещении. Когда они станут достаточно большими, чтобы их можно было обрабатывать, наколите саженцы в отдельные горшки и вырастите их в теплице на первую зиму. Высаживайте их на постоянное место в конце весны или в начале лета, после последних ожидаемых заморозков.
    Если у вас достаточно семян, возможно, стоит попробовать посев на открытом воздухе в грядку ранней весной.Выращивайте растения на семенном ложе в течение их первого года и высаживайте их следующей весной.
    Дивизия в марте или октябре. Используйте острую лопату или нож, чтобы разделить подвой, убедившись, что на каждой секции есть хотя бы одна ростковая почка. Очень просто, большие подразделения могут быть размещены прямо на их постоянных позициях. Мы обнаружили, что перед посадкой в ​​конце весны или в начале лета лучше высаживать более мелкие ветви и выращивать их в светлой тени в холодном помещении до тех пор, пока они не станут хорошо укоренившимися.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *